{"id":13278,"date":"2021-12-13T22:08:57","date_gmt":"2021-12-13T22:08:57","guid":{"rendered":"https:\/\/dreambody.clinic\/?page_id=13278"},"modified":"2024-04-01T01:22:26","modified_gmt":"2024-04-01T01:22:26","slug":"mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor","status":"publish","type":"page","link":"https:\/\/dreambody.clinic\/demo\/mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor\/","title":{"rendered":"Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor"},"content":{"rendered":"\n<h2 class=\"wp-block-heading\" id=\"h-introduction-for-mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor-study\">Introduction for Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor Study<\/h2>\n\n\n\n<p class=\"wp-block-paragraph\">Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor. <a href=\"https:\/\/dreambody.clinic\/demo\/index.php\/product\/kidney-failure-treatment-with-direct-stem-cell-injections\/\">To heal your kidneys check out Kidney Failure Treatment with Direct Stem Cell Injections at dream body clinic.<\/a><\/p>\n\n\n\n<p class=\"wp-block-paragraph\">Acute renal failure (ARF), also known as acute kidney injury, is a<br>rapid loss of renal functions due to damage to the kidneys, resulting in<br>retention of the nitrogenous compounds (urea and creatinine) and non<br>nitrogenous waste products that are normally excreted in urine [1].<br>Depending on the severity and duration of renal dysfunction,<br>this accumulation is accompanied by metabolic disturbances, such as<br>metabolic acidosis and hyperkalemia, changes in body fluid balance,<br>and effects on many other organ systems. It can be characterized by<br>oliguria or anuria [2]. It is a serious disease and treated as medical<br>emergency.<br>In clinical practice, ischemia-reperfusion (I\/R) injury is the most<br>common cause for acute renal failure. The pathogenic events in<br>ischemia\/reperfusion injury include acute tubular necrosis, apoptosis,<br>glomerular injury and inflammation.<br>Management of acute renal failure depends first on correction of<br>the metabolic abnormalities like the correction of hyperkalemia and<br>correction of metabolic acidosis then treatment of the cause as correction<br>of the hypovolemic state during shock or immunosuppressive therapy<br>for glomerulonephritis [3]. Although a number of agents and growth<br>factors have been proven effective in the amelioration of ARF in<br>otherwise healthy animals, no significantly effective new therapy has<br>been introduced into clinical practice in decades. It is for these reasons<br>that fundamentally new strategies for the treatment of ARF are needed.<br>Stem cell therapy holds a great promise for the repair of injured<br>tissues and organs, including the kidney. Stem cells are undifferentiated<br>cells that undergo both self-renewal and differentiation into one or<br>more cell types [4], &amp; are found in adult and embryonic tissues and<br>have potential uses in therapies designed to repair and regenerate<br>organs. There has been considerable focus on the ability of stem cells<br>to differentiate into non-haematopoietic cells of various tissue lineages,<br>including cells of the kidney [5]. This growing evidence has led to a<br>reconsideration of the source of cells contributing to renal repair<br>following injury.<br>The mechanism of action of stem cell therapy is unclear in most<br>disease conditions. Very-low-level organ engraftment of circulating<br>bone marrow-derived stem cells has been shown [6] but was not<br>corroborated by others [7]. The percentage of incorporated stem<br>cells varies widely, but it is usually below 1% in a given organ, and,<br>in addition, its magnitude depends on the studied disease model.<br>Other mechanistic possibilities for the therapeutic effects of stem cells<br>include fusion with resident organ cells [8], immunomodulation [9]<br>and paracrine mechanisms elicited through trophic mediators [10]<br>that result in the inhibition of fibrosis and apoptosis, enhancement of<br>angiogenesis, stimulation of mitosis and proliferation &amp; differentiation<br>of organ-intrinsic precursor of stem cells.<br>Hepatocyte growth factor (HGF), first identified by Russell et<br>al. [11] then purified and cloned by Nakamura et al. [12] as a potent<br>mitogen for fully differentiated hepatocytes.<br>Hepatocyte growth factor exerts mitogenic responses in renal<br>epithelial cells derived from distinct regions and species, including<br>rabbit and rat proximal tubular cells [13] and rat glomerular epithelial<br>cells. HGF stimulates the proliferation of renal epithelial cell lines,<br>including a rat visceral glomerular cell line [14], proximal tubular cell<br>lines [15]. Likewise, HGF exhibits mitogenic action on renal endothelial<br>cells [16].<br>Many studies demonstrated that HGF can play a role in the<br>treatment of renal diseases such as acute renal failure caused by<br>nephrotoxic drug administration (for example, cisplatin, cyclosporine<br>A, tacrolimus, and antibiotics) and renal ischemia [17].<br>This work aims: To study the effect of mesenchymal stem cells<br>(MSC) as a line of treatment for acute renal failure and the possible<br>mechanism by which they act through studying their effect on the<br>inflammatory and vascular manifestations. Also, to study the effect of<br>hepatocyte growth factor (HGF) as another line of treatment for acute<br>renal failure with comparison between both lines.<\/p>\n\n\n\n<p class=\"wp-block-paragraph\">Materials &amp; Methods<br>Preparation of the animal model<br>Experimental animals: The study was carried on 50 female white<br>albino rats, of an average weight 150-200 gm. Rats were bred and<br>maintained in an air-conditioned animal house with specific pathogenfree<br>conditions, and were subjected to a 12:12-h daylight\/darkness and<br>allowed unlimited access to chow and water. All the ethical protocols<br>for animal treatment were followed and supervised by the animal<br>facilities, Faculty of Medicine, Cairo University. They were divided into<br>5 groups as follow:<br>Group 1: 10 control female albino rats<br>Group (2) 10 female albino rats with induced acute renal failure<br>received saline.<br>Citation: Abdel Aziz MT, Wassef MA, Rashed LA, Mhfouz S, Omar N, et al. (2011) Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible<br>Role of Hepatocyte Growth Factor. J Stem Cell Res Ther 1:109. doi:10.4172\/2157-7633.1000109<br>Page 2 of 7<br>J Stem Cell Res Ther Volume 1 \u2022 Issue 3 \u2022 1000109<br>ISSN:2157-7633 JSCRT, an open access journal<br>Acute renal failure was induced by ischemia \/ reperfusion injury by<br>anaesthetizing the rats with sodium thiopental through intramuscular<br>injection then doing mid abdominal laparotomy then kidneys were<br>exposed and bilateral renal pedicles were clamped with atraumatic<br>vascular clamps for 60 minutes. Then the vascular clamp was released<br>to allow the reperfusion of the ischemic kidneys. The mid abdominal<br>laparotomy wound was then sealed by continuous 6\/0 stitches in 2<br>layers. Finally, antibiotic ointment (teramycin) &amp; powder (neomycin)<br>were applied to the wound [18].<br>Group (3) 10 female albino rats with induced ARF received HGF in<br>a dose of (o.25mg\/kg body weight) by IV infusion at the rat tail vein 24<br>hours after the induction of ARF.<br>Group (4) 10 female albino rats with induced ARF received MSCs,<br>which were processed and cultured for 14 days, in a dose of (107) by IV<br>infusion at the rat tail vein 24 hours after the induction of ARF.<br>Group (5) 10 female albino rats with induced ARF received both<br>MSCs, which were processed and cultured for 14 days, in a dose of (107)<br>&amp; HGF in a dose of (0.25mg\/kg body weight) by IV infusion at the rat<br>tail vein 24 hours after the induction of ARF.<br>Blood samples were collected from the retro-orbital vein. Sera were<br>separated and used for measurement of Creatinine &amp; urea.<br>The rats of all groups were sacrificed (by co2 narcosis) after 72 hours<br>of induction of the acute renal failure to obtain renal tissue specimens.<br>These tissues were examined for:<br>-quantitaive analysis of tumor necrosis factor-\u03b1 (TNF- \u03b1),<br>interleukin-10(IL-10), vascular endothelial growth factor (VEGF) gene<br>expression by Real Time PCR.<br>-Histopathological examination of renal tissue by haematoxylin<br>and eosine and by differential stains (periodic acid shift PAS stain and<br>masson trichrome stain).<br>-Detection of the MSCs homing in kidney tissue after its<br>labeling with PKH26 dye by fluorescent microscope to detect its red<br>fluorescence.<br>Preparation of BM -derived mesenchymal stem cells from<br>rats<br>Bone marrow was harvested by flushing the tibiae and femurs of<br>6-week-old male white albino rats with Dulbecco\u2019s modified Eagle\u2019s<br>medium (DMEM, GIBCO\/BRL) supplemented with 10% fetal bovine<br>serum (GIBCO\/BRL). Nucleated cells were isolated with a density<br>gradient [Ficoll\/Paque (Pharmacia)] and resuspended in complete<br>culture medium supplemented with 1% penicillin\u2013streptomycin<br>(GIBCO\/BRL). Cells were incubated at 37\u00b0C in 5% humidified CO2<br>for 12\u201314 days as primary culture or upon formation of large colonies.<br>When large colonies developed (80\u201390% confluence), cultures were<br>washed twice with phosphate buffer saline(PBS) and the cells were<br>trypsinized with 0.25% trypsin in 1mM EDTA (GIBCO\/BRL) for 5<br>min at 37\u00b0C. After centrifugation, cells were resuspended in serumsupplemented<br>medium and incubated in 50 cm2 culture flask (Falcon).<br>The resulting cultures were referred to as first-passage cultures [19].<br>Cells were identified as being MSCs by their morphology, adherence,<br>and their power to differentiate into osteocytes and chondrocytes.<br>Differentiation into osteocytes was achieved by adding 1-1000<br>nM dexamethasone, 0.25 mM ascorbic acid, and 1-10 mM betaglycerophosphate<br>to the medium. Differentiation of MSCs into<br>osteoblasts was confirmed by morphological changes, Alzarin red<br>staining of differentiated osteoblasts. Differentiation into chondrocyte<br>was achieved by adding 500 ng\/mL bone morphogenetic protein-2<br>(BMP-2;R&amp;D Systems, USA) and 10 ng\/ml transforming growth factor<br>b3 (TGFb3) (Peprotech, London) for 3 weeks. In vitro differentiation<br>into chondrocytes was confirmed by morphological changes, Alcian<br>blue staining of differentiated chondrocytes. CD29 gene expression<br>was also detected by RT-PCR as a marker of MSCs and CD45, CD44 by<br>flow cytometry analysis.<br>Labeling of MSCs with PKH26<br>MSCs were harvested during the 4th passage and were labeled<br>with PKH26, which is a red fluorochrome. It has excitation (551nm)<br>and emission (567 nm) characteristics compatible with rhodamine or<br>phycoerythrin detection systems. The linkers are physiologically stable<br>and show little to no toxic side-effects on cell systems. Labeled cells<br>retain both biological and proliferating activity, and are ideal for in<br>vitro cell labeling, in vitro proliferation studies and long, in vivo cell<br>tracking. In the current work, MSCs were labeled with PKH26from<br>Sigma Company (Saint Louis, Missouri USA). Cells were centrifuged<br>and washed twice in serum free medium. Cells were pelleted and<br>suspended in dye solution. Cells were injected intravenously into rat tail<br>vain. After one month, kidney tissue was examined with a fluorescence<br>microscope to detect and trace the cells.<br>RT-PCR Detection of CD29 gene expression<br>Total RNA was extracted from cells using RNeasy Purification<br>Reagent (Qiagen, Valencia, CA), and then a sample (1 \u03bcg) was reverse<br>transcribed with M-MLV (Moleny \u2013 Murine Leukemia virus) reverse<br>transcriptase (RT) for 30 minutes at 42\u00b0C in the presence of oligo-dT<br>primer. Polymerase chain reaction (PCR) was performed using specific<br>primers (UniGene Rn.25733) forward: 5\u2019-AA TGTTTCAGTGCA GA<br>GC-3\u2019 and reverse: 5\u2019- TTGGGAT GA TGTCGGGAC-3\u2019. PCR was<br>performed for 35 cycles, with each cycle consisting of denaturation<br>at 95\u00b0C for 30 seconds, annealing at 55\u00b0C to 63\u00b0C for 30 seconds,<br>and elongation at 72\u00b0C for 1 minute, with an additional 10-minute<br>incubation at 72\u00b0C after completion of the last cycle. To exclude the<br>possibility of contaminating genomic DNA, PCRs were also run without<br>RT. The PCR product was separated by electrophoresis through a 1%<br>agarose gel, stained, and photographed under ultraviolet light.<br>Real-time quantitative analyses for VEGF, TNF alpha and<br>IL10 gene expression<br>Total RNA was extracted from kidney tissue homogenate using<br>RNeasy purification reagent (Qiagen, Valencia, CA). cDNA was<br>generated from 5 \u03bcg of total RNA extracted with 1 \u03bcl (20 pmol)<br>antisense primer and 0.8 \u03bcl superscript AMV reverse transcriptase for<br>60 min at 37\u00b0C.<br>The relative abundance of mRNA species was assessed using the<br>SYBR\u00ae Green method on an ABI prism 7500 sequence detector system<br>(Applied Biosystems, Foster City, CA). PCR primers were designed<br>with Gene Runner Software (Hasting Software, Inc., Hasting, NY)<br>from RNA sequences from GenBank (Table 1). All primer sets had<br>a calculated annealing temperature of 60\u00b0. Quantitative RT-PCR<br>was performed in duplicate in a 25-\u03bcl reaction volume consisting of<br>2X SYBR Green PCR Master Mix (Applied Biosystems), 900 nM of<br>Citation: Abdel Aziz MT, Wassef MA, Rashed LA, Mhfouz S, Omar N, et al. (2011) Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible<br>Role of Hepatocyte Growth Factor. J Stem Cell Res Ther 1:109. doi:10.4172\/2157-7633.1000109<br>Page 3 of 7<br>J Stem Cell Res Ther Volume 1 \u2022 Issue 3 \u2022 1000109<br>ISSN:2157-7633 JSCRT, an open access journal<br>each primer and 2-3 \u03bcl of cDNA. Amplification conditions were 2<br>min at 50\u00b0, 10 min at 95\u00b0 and 40 cycles of denaturation for 15 s and<br>annealing\/extension at 60\u00b0 for 10 min. Data from real-time assays<br>were calculated using the v1\u00b77 Sequence Detection Software from PE<br>Biosystems (Foster City, CA). Relative expression of VEGF, TNF alpha<br>and IL10mRNA was calculated using the comparative Ct method. All<br>values were normalized to the beta actin genes and reported as fold<br>change over background levels detected in ARF.<br>Biochemical analysis<br>Serum urea and creatinine levels were measured using the<br>conventional colorimetric method using Quanti Chrom TM assay kits<br>based on the improved Jung and Jaffe methods, respectively (DIUR-<br>500 and DICT-500).<br>Analysis of kidney histopathology<br>Kidney samples were collected into PBS and fixed overnight in 40<br>g\/L paraformaldehyde in PBS at 4\u00b0C. Serial 5-\u03bcm sections of the cortex<br>and the medulla of the kidney were stained with hematoxylin and eosin<br>(H&amp;E).<br>Statistical analysis<br>Data were expressed as mean \u00b1 SD. Significant differences<br>were determined by using ANOVA and post-hoc tests for multiple<br>comparisons using SPSS 9.0 computer Software. Results were<br>considered significant at p&lt;0.05.<br>Results<br>MSCs culture, identification &amp; homing<br>Isolated and cultured undifferentiated MSCs reached 70-<br>80% confluence at 14 days .In vitro osteogenic and chondrogenic<br>differentiation of MSCs were confirmed by morphological changes and<br>special stains (Figure 1A,B and Figure 2A,B respectively) in addition<br>MSCs were identified by surface marker CD45 (-ve) &amp; CD44 (+ve)<br>detected by flow cytometry and CD29 (+) by PCR (Figure 3A,B&amp;C)<br>respectively. MSCs labeled with PKH26 fluorescent dye was detected<br>in the renal tissues confirming that these cells homed into the kidney<br>tissue (Figure 4).<br>MSCs and or HGF improve the kidney function<br>The results of the present study show a significant improvement<br>in kidney function . Serum urea and creatinine were decreased in the<br>ARF\/MSC, ARF\/HGF groups compared to the ARF group ((P&lt;0.05)<br>(Table 1).<br>Gene expression of inflammatory and angiogenic markers<br>Concerning gene expression, VEGF &amp; IL-10 genes were<br>significantly decreased in ARF group (P&lt;0.05) compared to control<br>group. Whereas their level was significantly increased in the group<br>that received either MSC alone or MSC and HGF but insignificant in<br>group that received HGF alone (Figure 5), also these factors showed<br>negative correlation with P value= P&lt;0.05and R value = &#8211; 0.686 and<br>P value= P&lt;0.05and R value = &#8211; 0.744 (Figure 6B&amp;C) respectively. On<br>the other hand, the TNF-\u03b1 gene which is one of inflammatory marker<br>significantly decreased in the rat group that received either MSC alone<br>Figure 1: Morphological and histological staining of differentiated BM-MSCs<br>into osteoblasts. (A) (\u00d720) Arrows for differentiated MSCs osteoblasts after<br>addition of growth factors. (B) (\u00d7200) Differentiated MSCs into osteoblasts<br>stained with Alizarin red stain..<br>Figure 2: Morphological and histological staining of differentiated BM-MSCs<br>into chondrocytes. (A) (\u00d720) Arrows for differentiated MSCs chondrocytes after<br>addition of growth factors. (B) (\u00d7200) Differentiated MSCs into chondrocytes<br>stained with Alcian blue stain.<br>Figure 3: Flow cytometric characterization analyses of bone marrow-derived<br>MSCs. Cells were uniformly negative for CD45(A), and positive for CD44(B).<br>Figure 3(C) Agarose electrophoresis of CD29 PCR products of MSC in culture.<br>(A) CD 45- (B)CD 44+ (D) CD29<br>Figure 4: Detection of MSCs labeled with PKH26 fluorescent dye in kidney<br>tissue. MSCs labeled with the PKH26 showed strong red autofluorescence<br>after transplantation into rats, confirming that these cells were seeded into the<br>kidney tissue.<br>Citation: Abdel Aziz MT, Wassef MA, Rashed LA, Mhfouz S, Omar N, et al. (2011) Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible<br>Role of Hepatocyte Growth Factor. J Stem Cell Res Ther 1:109. doi:10.4172\/2157-7633.1000109<br>Page 4 of 7<br>J Stem Cell Res Ther Volume 1 \u2022 Issue 3 \u2022 1000109<br>ISSN:2157-7633 JSCRT, an open access journal<br>or MSC and HGF but insignificant in group that received HGF alone<br>(Figure 5) and a significant positive correlation with serum creatinine<br>concentration among the studied groups (Figure 6A) with P value=<br>P&lt;0.05 and R value = 0.868.<br>Histopathological changes<br>Histopathological examination of kidney tissue of ARF group<br>showed Tubular atrophy of both proximal &amp; distal tubules with marked<br>lumen dilatation &amp; cell debris in lumen &amp; patchy loss of proximal tubule<br>cells with regenerative change in tubular cells. (Figure 7 A PASX400)<br>following MSC injection there was dense interstitial, periglomerular,<br>perivascular and diffuse interstitial tissue infiltrates of cells between<br>tubules at corticomedullary junction (Figure 7 B( PAS X400 X1000).<br>In ARF\/HGF there was minimal kidney damage with Patchy focal<br>glomerular dilatation of Bowman\u2019s space. The space is partially<br>filled with fibrin and cell debris (Figure 7C (HEX200) while in ARF\/<br>MSCs+HGF there was cellular infilteration (Figure 7 D (HEX200).<br>Discussion<br>Bone marrow\u2013derived stem cells contribute to cell turnover<br>and repair in various tissue types, including the kidneys [20,21].<br>Mesenchymal stem cells (MSCs) are attractive candidates for renal<br>repair, because nephrons are of mesenchymal origin and because<br>stromal cells are of crucial importance for signaling, leading to<br>differentiation of both nephrons and collecting ducts [22]. MSCs<br>are commonly defined as bone marrow\u2013derived fibroblast-like cells,<br>which despite the lack of specific surface markers can be selected by<br>their adherence characteristics in vitro and which have the ability<br>to differentiate along the three principal mesenchymal lineages:<br>osteoblastic, adipocytic, and chondrocytic [23,24]. In the present study,<br>bone marrow derived mesenchymal stem cells were isolated from male<br>rats, grown and characterized by their adhesiveness and fusiform shape<br>and by detection of CD 29, one of surface marker of rat mesenchymal<br>stem cells and were used to detect their possible anti-inflammatory and<br>vascular role in amelioration of renal function in experimental model<br>Figure 5: Quantitave analysis of VEGF(A) , IL-10 (B) &amp;TNF-\u03b1(C) gene expression by real time PCR in different groups(# significant difference to ARF group).<br>(A) (B) (C)<br>Figure 6: Correlation between TNF-\u03b1 (A), IL-10 (B) &amp; VEGF(C) with creatinine(B&amp;C significant positive correlation (A) significant negative correlation).<br>A B C<br>Citation: Abdel Aziz MT, Wassef MA, Rashed LA, Mhfouz S, Omar N, et al. (2011) Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible<br>Role of Hepatocyte Growth Factor. J Stem Cell Res Ther 1:109. doi:10.4172\/2157-7633.1000109<br>Page 5 of 7<br>J Stem Cell Res Ther Volume 1 \u2022 Issue 3 \u2022 1000109<br>ISSN:2157-7633 JSCRT, an open access journal<br>of acute renal fai decrease in serum urea and creatinine concentrations<br>than those of the ARF group. Our results were similar to those of Dai<br>[27], who proved that a Single Injection of naked plasmid encoding<br>hepatocyte growth factor prevented cell death and ameliorated acute<br>renal functions in mice. The possible mechanism is that hepatocyte<br>growth factor exerts mitogenic responses in renal epithelial cells<br>derived from distinct regions and species, including rabbit and rat<br>proximal tubular cells .HGF also stimulates the proliferation of renal<br>epithelial cell lines, including a rat visceral glomerular cell line [14],<br>proximal tubular cell lines [15].<br>Following stem cell injection, those donors cells could be detected<br>in recipient failing kidneys by autofluorescence that appeared in kidney<br>tissue after MSCs injection .The result of the present work showed<br>strong red auto fluorescence after transplantation in rats, confirming<br>Figure 7: Histopathological examination of renal tissues in different groups:<br>(A)ARF showed atrophy and patchy necrosis of proximal and distal renal<br>tubules &amp; cell debris in the lumen. (B)ARF+ MSC(B) &amp; ARF+MSC+HGF(D)<br>showing dense interstitial tissue infiltrate between tubules at corticomedullary<br>junction.(D)ARF+HGF (C), showed fibrin and cell debris in cortical tubules.<br>A B<br>C D<br>Primer sequence<br>VEGF Forward:5&#8217;GCCTGAAATCTACCAGATCATGTTG 3\u0384<br>Reverse:3&#8217;TTCCACAAGCTCCACGAATCTT 5\u0384<br>TNF-\u03b1 Forward :5&#8242; GACCCTCACACTCAG ATC ATC TTC T -3&#8242;<br>Reverse :3&#8242; TTGTCTTTGAGATCCATGCCA TT 5&#8242;<br>IL-10 Forward :5\u0384 GAA GCT GAA GAC CCT CTG GAT ACA 3\u0384<br>Reverse : 3\u0384 TTG TCT TTG AGA TCC ATG CCA TT 5\u0384<br>Beta actin forward 5&#8242;-TGTTGTCCCTGTATGCCTCT-3&#8242;<br>reverse 3&#8242;-TAATGTCACGCACGATTTCC-5&#8242;<br>Table 1: Sequence of the primers used for real-time PCR.<br>Table 2: Serum urea (mg\/dl) &amp; creatinine (mg\/dl) in different studied groups:<br>*Significant p as compared to control group (P&lt;0.05)<\/p>\n\n\n\n<h1 class=\"wp-block-heading\">Significant p as compared to ARF group (P&lt;0.05)<\/h1>\n\n\n\n<p class=\"wp-block-paragraph\">$Significant p as compared to ARF with HGF group (P&lt;0.05)<br>groups urea (mg\/dl) mean\u00b1 SD creatinine (mg\/dl) mean\u00b1 SD<br>control 33.39 \u00b1 7.95 0.16 \u00b1 0.08<br>ARF 82.73 \u00b1 10.28* 1.63 \u00b1 0.44*<br>ARF with HGF 69.79 \u00b1 7.52<em># 1.06 \u00b1 0.27<\/em>#<br>ARF with stem cells 49.28 \u00b1 6.31<em>#$ 0.6 \u00b1 0.16<\/em>#$$<br>ARF with stem cells &amp; HGF 43.73 \u00b1 9.20<em>#$ 0.5 \u00b1 0.11<\/em>#$<br>that these cells were actually insinuating themselves into the renal tissue<br>as detected by fluorescent microscope. This result was in accordance to<br>that reported by Morigi et al. [28], who labeled a human bone marrow<br>MSCs with PKH 26 dye and administered it into mice with induced<br>acute renal failure and found the red fluorescence of the MSC.<br>Fusion or transdifferentiation, this could not be answered in this<br>study, However, both techniques definitely proved that those cells were<br>able to maintain high population all through the study, in other words,<br>for 3 days following MSC injection. These results agree with those<br>of Li et al. [29]; who showed 50% replacement of proximal tubular<br>cells with donor cells. These results also agree with Rookmaaker et<br>al. [30]; who declared that bone-marrow-derived cells may home to<br>injured glomerular endothelium, differentiate into endothelial cells,<br>and participate in regeneration of the highly specialized glomerular<br>microvasculature. In addition, they confirmed previous observations<br>that bone-marrow-derived cells can replace injured mesangial cells<br>[31]. T\u00f6gel et al. [18]; stated that infused MSC were detected in the<br>kidney only early after administration and were predominantly in<br>glomeruli<br>Duffield et al. [32]; state that BDMC contribute a regenerative<br>cytokine environment that may be important in the resulting functional<br>repair. Similarly, it was found that bone marrow\u2013derived stem cells<br>seemed to contribute relatively small numbers of cells (3 to 22%) to<br>regenerating renal tubular [33] and glomerular cell populations [21];<br>that is, the majority of reparative cells were derived from intrinsic<br>kidney cells. Regardless the cause, whether it\u2019s MSC differentiation,<br>fusion or merely cytokine induced renal improvement; following MSC<br>injection, the results of the present work showed increase in IL10 and<br>VEGF and decrease in TNF gene expression in renal tissues. Several<br>studies stated that after 24 h of MSCs infusion, only exceptionally scarce<br>numbers of MSCs were found in the kidney, a pattern that essentially<br>rules out the possibility that significant numbers of infused MSCs are<br>retained in the kidney where they could physically replace lost kidney<br>cells by transdifferentiation. This conclusion is furthermore supported<br>by the fact that there were no intrarenal transdifferentiation events<br>of MSC within 3 days of administration, whereas occasional MSCderived<br>capillary endothelial cells were identified only after 5\u20137 days.<br>From this, it could be deduced that the mechanisms that mediate the<br>protective effects of MSC must be primarily paracrine. This is proved<br>by their expression of several growth factors such as HGF, VEGF, and<br>IGF-I, all known to improve renal function in CRF, mediated by their<br>antiapoptotic, mitogenic and other cytokine actions. Collectively,<br>these as yet incompletely defined paracrine actions of MSC result in<br>the renal downregulation of proinflammatory cytokines IL-1\u03b2, TNF-\u03b1,<br>and IFN-\u03b3, as well as iNOS, and upregulation of anti-inflammatory<br>and organ-protective IL-10 [34], as well as bFGF, TGF-\u03b1, and Bcl-<\/p>\n\n\n\n<ol class=\"wp-block-list\" start=\"2\"><li>The lack of renoprotection obtained by infused fibroblasts may<br>be due, at least in part, to the fact that MSC exhibit a comparatively<br>higher expression of VEGF, HGF, and IGF-I, therefore suggesting that<br>the combined delivery, by MSC, of these factors appears to result in<br>superior renoprotection than that obtained with the growth factors<br>that are more highly expressed by fibroblasts (EGF, HB-EGF, BMP-7,<br>bFGF).<br>Histopathological examination of renal tissue samples of ARF group<br>showed increased congestion &amp; increased cellularity of the glomeruli &amp;<br>fibrin deposition. There was also patchy tubular atrophy &amp; necrosis. On<br>Citation: Abdel Aziz MT, Wassef MA, Rashed LA, Mhfouz S, Omar N, et al. (2011) Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible<br>Role of Hepatocyte Growth Factor. J Stem Cell Res Ther 1:109. doi:10.4172\/2157-7633.1000109<br>Page 6 of 7<br>J Stem Cell Res Ther Volume 1 \u2022 Issue 3 \u2022 1000109<br>ISSN:2157-7633 JSCRT, an open access journal<br>the other hand normal medullary tubules with vacuolar degeneration<br>as a late event were seen. Interstitial edema &amp; mild inflammation also<br>occurred. MT showed dense fibrosis invaded by a dense collection of<br>MSCs which were indicated by autofluorescence in kidney tissue after<br>MSCs injection. Those were examined with H&amp;E stain, that is a more<br>sensitive detector regarding cellular infiltration, &amp; finally with Mason<br>Dichromate, which is a better detector of collagen fibers hence, fibrosis<br>&amp; scaring. The present findings agreed with those of [29]; who recorded<br>similar perivascular &amp; periglomerular infiltration. In addition, they<br>reported cell fusion, with occurrence of binucleated cells.<br>In the current study when HGF was administered after 24 hours,<br>there were patchy focal glomerular dilatation of Bowman\u2019s space<br>and the space was partially filled with fibrin and cell debris. Rest of<br>glomeruli appeared normal. Cortical tubules showed patchy areas of<br>minimal necrosis &amp; degeneration mostly hyaline &amp; vacuolar as well<br>as atrophy &amp; tubular dilatation. This finding agreed with Kawaida K<br>et al. [35], who stated that HGF prevents ARF and accelerates renal<br>regeneration in mice and in accordance with Miller et al. [36], who<br>stated that Hepatocyte growth factor accelerates recovery from acute<br>ischemic renal injury in rats.<br>Using stem cell\u2013enriching and\/or cytokine-enriching strategies<br>after ARF, we found the effect of the injected cytokines HGF to be<br>more important to improve kidney function than the transplanted<br>MSCs alone. Our data therefore support the emerging findings that<br>stem cell therapy may enhance kidney function primarily via paracrine<br>mechanisms as opposed to a regeneration of new renal tissue. Although<br>MSCs are capable of producing a great variety of cytokines, including<br>HGF. HGF -enhanced MSCs showed increased cytokine expression<br>in vivo and maximized the beneficial paracrine effects of MSC<br>transplantation.<br>In conclusion, MSC &amp; HGF can exert their effect by paracrine<br>mechanisms through down regulation of proinflammatory cytokine<br>TNF-\u03b1 and up regulation of anti-inflammatory IL-10 and VEGF.<br>References<\/li><li>Albright RC Jr (2001) Acute renal failure: a practical update. Mayo Clin Proc 76:<br>67-74.<\/li><li>Singri N, Ahya SN, Levin ML (2003) Acute renal failure. JAMA 289: 747-751.<\/li><li>Kodner CM, Kudrimoti A (2003) Diagnosis and management of acute interstitial<br>nephritis. Am Fam Physician 67: 2527-3534.<\/li><li>Weissman IL (2000) a: Stem cells: units of development, units of regeneration,<br>and units in evolution. Cell 100: 157\u2013168.<\/li><li>Oswald J, Boxberger S, Jorgensen B, Feldmann S, et al. (2004) Mesenchymal<br>stem cells can be differentiated into endothelial cells in vitro. Stem Cells 22:<br>377\u2013384.<\/li><li>Orlic D, Kajstura J, Ghimenti S, Jakoniuk I, et al (2001) Bone marrow cells<br>regenerate infracted myocardium. Nature 410: 701-705.<\/li><li>Balsam LB, Wagers AJ, Christensen JL, Kofidis T, et al. (2004) Hematopoietic<br>stem cells adopt mature hematopoietic fates in ischemic myocardium. Nature<br>428: 668\u2013673.<\/li><li>Wurmser AE, Gage FH (2002) Stem cells: cell fusion causes confusion. Nature<br>416: 485\u2013487.<\/li><li>Aggarwal S, Pittenger MF (2005) Human mesenchymal stem cells modulate<br>allogeneic immune cell responses. Blood 105: 1815-1822.<\/li><li>Caplan AI, Dennis JE (2006) Mesenchymal stem cells as trophic mediators. J<br>Cell Biochem 98: 1076-1084.<\/li><li>Russell WE, McGowan JA, Bucher NLR (1984) Partial characterization of<br>hepatocyte growth factor from rat platelets. J Cell Physiol 119: 183\u2013192.<\/li><li>Nakamura T, Teramoto H, Ichihara A (1986) Purification and characterization<br>of a growth factor from rat platelets for mature parenchymal hepatocytes in<br>culture. Proc Natl Acad Sci U S A 83: 6489\u20136493.<\/li><li>Harris RC, Burns KD, Alattar M, Homma T, et al. (1993) Hepatocyte growth<br>factor stimulates phosphoinositide hydrolysis and mitogenesis in cultured renal<br>epithelial cells. Life Sci 52: 1091\u20131110.<\/li><li>Kawaguchi M, Kawashima F, Ohshima K, Wada H, et al. (1994) Hepatocyte<br>growth factor is a potent promoter of mitogenesis in cultured rat visceral<br>glomerular epithelial cells. Cell Mol Bio 40: 1103\u20131111.<\/li><li>Ishibashi K, Sasaki S, Sakamoto H, Nakamura Y, et al. (1992) Hepatocyte<br>growth factor is a paracrine factor for renal epithelial cells: Stimulation of DNA<br>synthesis and Na, K-ATPase activity. Biochem Biophys Res Commun; 182:<br>960\u2013965.<\/li><li>Yo Y, Morishita R, Yamamoto K, Tomita N, et al. (1998) Actions of hepatocyte<br>growth factor as a local modulator in the kidney: Potential role in pathogenesis<br>of renal disease. Kidney Int 53: 50\u201358.<\/li><li>Matsumoto K, Nakamura T (2001) Hepatocyte growth factor; renotropic role<br>and potential therapeutics for renal diseases. Kidney Int 59: 2023 \u20132038.<\/li><li>T\u00f6gel F, Hu Z, Weiss K, Isaac J, Lange C, et al. (2005) Administered<br>mesenchymal stem cells protect against ischemic acute renal failure through<br>differentiation-independent mechanisms. Am J Physiol Renal Physiol 289: F31-<br>42.<\/li><li>Abdel Aziz MT, Atta H, Mahfouz S., Fouad HH, Roshdy NK, et al. (2007)<br>Therapeutic potential of bone marrow-derived mesenchymal stem cells on<br>experimental liver cirrhosis. Clin Biochem 40: 893-899.<\/li><li>Cornacchia F, Fornoni A, Plati AR, Thomas A, et al. (2001) Glomerulosclerosis<br>is transmitted by bone \u2013marrow drived mesangial progenitors. J Clin Invest<br>108: 1649-1656.<\/li><li>Poulsom R, Forbes SJ, Hodivala-DHke K, Ryan E, et al. (2001) Bone marrow<br>contributes to renal parenchymal turnover and regeneration. J Pathol 195: 229-<br>235.<\/li><li>Anglani F, Forino M, Del Prete D, Tosetto E, Torregrossa R, et al. (2004) In<br>search of adult renal stem cells. J Cell Mol Med 8: 474\u2013487.<\/li><li>Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, et al. (1999) Multilineage<br>potential of adult human mesenchymal stem cells. Science 284: 143-147.<\/li><li>Imai E, Ito T (2002) Can bone marrow differentiate into renal cells. Pediatr<br>Nephrol 17: 790-794.<\/li><li>Lange C, T\u00f6gel F, Ittrich H, Clayton F, et al. (2005) Administered mesenchymal<br>stem cells enhance recovery from ischemia\/reperfusion\u2013induced acute renal<br>failure in rats, Kidney International 68: 1613\u20131617.<\/li><li>Semedo P , Wanga PM, Andreuccia TH, Cenedezea MA, et al. (2007)<br>Mesenchymal Stem Cells Ameliorate Tissue Damages Triggered by Renal<br>Ischemia and Reperfusion Injury Transplantation Proceedings 39: 421-423.<\/li><li>Dai C, Yang J, Liu Y (2002) Single Injection of Naked Plasmid Encoding<br>Hepatocyte Growth Factor Prevents Cell Death and Ameliorates Acute Renal<br>Failure in Mice. J Am Soc Nephrol 13: 411-422.<\/li><li>Morigi M, Introna M, Imberti B, Corna D, et al. (2008) Human Bone Marrow<br>Mesenchymal Stem Cells Accelerate Recovery of Acute Renal Injury and<br>Prolong Survival in Mice Stem Cells 26: 2075 -2082.<\/li><li>Ling L, Truong P, Igarashi P, Lin F (2007) Renal and Bone Marrow Cells Fuse<br>after Renal Ischemic Injury. J Am Soc Nephrol 18: 3067-3077.<\/li><li>Rookmaaker MB, Verhaar MC, de Boer HC, et al. (2007) Met-RANTES reduces<br>endothelial progenitor cell homing to activated (glomerular) endothelium in vitro<br>and in vivo. Am J Physiol Renal Physiol 293: F624-630.<\/li><li>Ito T, Suzuki A, Okabe M, Imai E, et al (2001) Application of bone marrowderived<br>stem cells in experimental nephrology. Exp Nephrol 9: 444\u2013450.<\/li><li>Duffield JS, Bonventre JV (2005) Kidney tubular epithelium is restored without<br>Citation: Abdel Aziz MT, Wassef MA, Rashed LA, Mhfouz S, Omar N, et al. (2011) Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible<br>Role of Hepatocyte Growth Factor. J Stem Cell Res Ther 1:109. doi:10.4172\/2157-7633.1000109<br>Page 7 of 7<br>J Stem Cell Res Ther Volume 1 \u2022 Issue 3 \u2022 1000109<br>ISSN:2157-7633 JSCRT, an open access journal<br>replacement with bone marrow-derived cells during repair after ischemic injury.<br>Kidney Int 68:1956-1961.<\/li><li>Chishti AS, Sorof JM, Brewer ED, Kale AS (2001) Long-term treatment of focal<br>segmental glomerulosclerosis in children with cyclosporine given as a single<br>daily dose.Am J Kidney Dis 38: 754-760.<\/li><li>Deng J, Kohda Y, Chiao H, Wang Y, Hu X, et al. (2001) Interleukin-10 inhibits<br>ischemic and cisplatin-induced acute renal injury. Kidney Int 60: 2118-2128.<\/li><li>Kawaida K, Matsumoto K, Shimazu H, Nakamura T (1994) Hepatocyte growth<br>factor prevents acute renal failure and accelerates renal regeneration in mice.<br>Proc Natl Acad Sci USA 91: 4357-4361.<\/li><li>Miller SB, Martin DR, Kissane J, Hammerman MR (1994) Hepatocyte growth<br>factor accelerates recovery from acute ischemic renal injury in rats. Am J<br>Physiol 266: F129-F134.<\/li><\/ol>\n\n\n\n<figure class=\"wp-block-image size-large\"><img fetchpriority=\"high\" decoding=\"async\" width=\"1024\" height=\"683\" src=\"https:\/\/dreambody.clinic\/demo\/wp-content\/uploads\/2021\/12\/Mesenchymal-Stem-Cells-Therapy-in-Acute-Renal-Failure_-Possible-Role-of-Hepatocyte-Growth-Factor-1024x683.webp\" alt=\"\" class=\"wp-image-13281\" srcset=\"https:\/\/dreambody.clinic\/demo\/wp-content\/uploads\/2021\/12\/Mesenchymal-Stem-Cells-Therapy-in-Acute-Renal-Failure_-Possible-Role-of-Hepatocyte-Growth-Factor-1024x683.webp 1024w, https:\/\/dreambody.clinic\/demo\/wp-content\/uploads\/2021\/12\/Mesenchymal-Stem-Cells-Therapy-in-Acute-Renal-Failure_-Possible-Role-of-Hepatocyte-Growth-Factor-300x200.webp 300w, https:\/\/dreambody.clinic\/demo\/wp-content\/uploads\/2021\/12\/Mesenchymal-Stem-Cells-Therapy-in-Acute-Renal-Failure_-Possible-Role-of-Hepatocyte-Growth-Factor-768x512.webp 768w, https:\/\/dreambody.clinic\/demo\/wp-content\/uploads\/2021\/12\/Mesenchymal-Stem-Cells-Therapy-in-Acute-Renal-Failure_-Possible-Role-of-Hepatocyte-Growth-Factor-600x400.webp 600w, https:\/\/dreambody.clinic\/demo\/wp-content\/uploads\/2021\/12\/Mesenchymal-Stem-Cells-Therapy-in-Acute-Renal-Failure_-Possible-Role-of-Hepatocyte-Growth-Factor.webp 1200w\" sizes=\"(max-width: 1024px) 100vw, 1024px\" \/><\/figure>\n","protected":false},"excerpt":{"rendered":"<p>Introduction for Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor Study Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor. To heal your kidneys check out Kidney Failure Treatment with Direct Stem Cell Injections at dream body clinic. Acute renal failure (ARF), also known&hellip;<\/p>\n","protected":false},"author":1,"featured_media":13282,"parent":0,"menu_order":0,"comment_status":"closed","ping_status":"closed","template":"","meta":{"rs_blank_template":"","rs_page_bg_color":"","slide_template_v7":"","_monsterinsights_skip_tracking":false,"_monsterinsights_sitenote_active":false,"_monsterinsights_sitenote_note":"","_monsterinsights_sitenote_category":0,"footnotes":""},"class_list":["post-13278","page","type-page","status-publish","has-post-thumbnail","hentry","description-off"],"yoast_head":"<!-- This site is optimized with the Yoast SEO Premium plugin v27.2 (Yoast SEO v28.0) - https:\/\/yoast.com\/product\/yoast-seo-premium-wordpress\/ -->\n<title>Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor - Dream Body Clinic Stem Cell Therapy Puerto Vallarta Mexico 2026 &amp; HGH<\/title>\n<meta name=\"description\" content=\"Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor. Kidney Failure stem cell treatment\" \/>\n<meta name=\"robots\" content=\"noindex, follow, max-snippet:-1, max-image-preview:large, max-video-preview:-1\" \/>\n<meta property=\"og:locale\" content=\"en_US\" \/>\n<meta property=\"og:type\" content=\"article\" \/>\n<meta property=\"og:title\" content=\"Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor\" \/>\n<meta property=\"og:description\" content=\"Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor. Kidney Failure stem cell treatment\" \/>\n<meta property=\"og:url\" content=\"https:\/\/dreambody.clinic\/demo\/mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor\/\" \/>\n<meta property=\"og:site_name\" content=\"Dream Body Clinic Stem Cell Therapy Puerto Vallarta Mexico 2026 &amp; HGH\" \/>\n<meta property=\"article:publisher\" content=\"https:\/\/www.facebook.com\/dreambodyclinic\" \/>\n<meta property=\"article:modified_time\" content=\"2024-04-01T01:22:26+00:00\" \/>\n<meta property=\"og:image\" content=\"https:\/\/dreambody.clinic\/demo\/wp-content\/uploads\/2021\/12\/Mesenchymal-Stem-Cells-Therapy-in-Acute-Renal-Failure_-Possible-Role-of-Hepatocyte-Growth-Factor-1.webp\" \/>\n\t<meta property=\"og:image:width\" content=\"1200\" \/>\n\t<meta property=\"og:image:height\" content=\"800\" \/>\n\t<meta property=\"og:image:type\" content=\"image\/webp\" \/>\n<meta name=\"twitter:card\" content=\"summary_large_image\" \/>\n<meta name=\"twitter:site\" content=\"@DreamBodyClinic\" \/>\n<meta name=\"twitter:label1\" content=\"Est. reading time\" \/>\n\t<meta name=\"twitter:data1\" content=\"23 minutes\" \/>\n<script type=\"application\/ld+json\" class=\"yoast-schema-graph\">{\"@context\":\"https:\\\/\\\/schema.org\",\"@graph\":[{\"@type\":\"WebPage\",\"@id\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor\\\/\",\"url\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor\\\/\",\"name\":\"Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor - Dream Body Clinic Stem Cell Therapy Puerto Vallarta Mexico 2026 &amp; HGH\",\"isPartOf\":{\"@id\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/#website\"},\"primaryImageOfPage\":{\"@id\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor\\\/#primaryimage\"},\"image\":{\"@id\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor\\\/#primaryimage\"},\"thumbnailUrl\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/wp-content\\\/uploads\\\/2021\\\/12\\\/Mesenchymal-Stem-Cells-Therapy-in-Acute-Renal-Failure_-Possible-Role-of-Hepatocyte-Growth-Factor-1.webp\",\"datePublished\":\"2021-12-13T22:08:57+00:00\",\"dateModified\":\"2024-04-01T01:22:26+00:00\",\"description\":\"Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor. Kidney Failure stem cell treatment\",\"breadcrumb\":{\"@id\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor\\\/#breadcrumb\"},\"inLanguage\":\"en-US\",\"potentialAction\":[{\"@type\":\"ReadAction\",\"target\":[\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor\\\/\"]}]},{\"@type\":\"ImageObject\",\"inLanguage\":\"en-US\",\"@id\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor\\\/#primaryimage\",\"url\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/wp-content\\\/uploads\\\/2021\\\/12\\\/Mesenchymal-Stem-Cells-Therapy-in-Acute-Renal-Failure_-Possible-Role-of-Hepatocyte-Growth-Factor-1.webp\",\"contentUrl\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/wp-content\\\/uploads\\\/2021\\\/12\\\/Mesenchymal-Stem-Cells-Therapy-in-Acute-Renal-Failure_-Possible-Role-of-Hepatocyte-Growth-Factor-1.webp\",\"width\":1200,\"height\":800},{\"@type\":\"BreadcrumbList\",\"@id\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor\\\/#breadcrumb\",\"itemListElement\":[{\"@type\":\"ListItem\",\"position\":1,\"name\":\"Home\",\"item\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/\"},{\"@type\":\"ListItem\",\"position\":2,\"name\":\"Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor\"}]},{\"@type\":\"WebSite\",\"@id\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/#website\",\"url\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/\",\"name\":\"Dream Body Clinic\",\"description\":\"Dream Body Clinic Stem Cells - Stem Cell Therapy Puerto Vallarta Mexico  2026 &amp; HGH\",\"publisher\":{\"@id\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/#organization\"},\"alternateName\":\"dreambodyclinic\",\"potentialAction\":[{\"@type\":\"SearchAction\",\"target\":{\"@type\":\"EntryPoint\",\"urlTemplate\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/?s={search_term_string}\"},\"query-input\":{\"@type\":\"PropertyValueSpecification\",\"valueRequired\":true,\"valueName\":\"search_term_string\"}}],\"inLanguage\":\"en-US\"},{\"@type\":\"Organization\",\"@id\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/#organization\",\"name\":\"Dream Body Clinic\",\"url\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/\",\"logo\":{\"@type\":\"ImageObject\",\"inLanguage\":\"en-US\",\"@id\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/#\\\/schema\\\/logo\\\/image\\\/\",\"url\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/wp-content\\\/uploads\\\/2023\\\/06\\\/logotipo-dream-body-clinic-a-color-sin-fondo.webp\",\"contentUrl\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/wp-content\\\/uploads\\\/2023\\\/06\\\/logotipo-dream-body-clinic-a-color-sin-fondo.webp\",\"width\":1920,\"height\":1305,\"caption\":\"Dream Body Clinic\"},\"image\":{\"@id\":\"https:\\\/\\\/dreambody.clinic\\\/demo\\\/#\\\/schema\\\/logo\\\/image\\\/\"},\"sameAs\":[\"https:\\\/\\\/www.facebook.com\\\/dreambodyclinic\",\"https:\\\/\\\/x.com\\\/DreamBodyClinic\",\"http:\\\/\\\/instagram.com\\\/jtkjtk\",\"https:\\\/\\\/twitter.com\\\/DreamBodyClinic\",\"https:\\\/\\\/www.pinterest.com.mx\\\/clinic1831\\\/\",\"https:\\\/\\\/www.youtube.com\\\/channel\\\/UC9NfLfVu_mio--j4U3GO4sw\"],\"description\":\"Dream Body Clinic is the Premier Destination for Mesenchymal Stem Cell Therapy and Regenerative Medicines such as Human Growth Hormone (HGH).\",\"email\":\"info@dreambodyclinic.net\",\"telephone\":\"8887043977\",\"legalName\":\"Dream Body Clinic\",\"foundingDate\":\"2013-01-18\"}]}<\/script>\n<!-- \/ Yoast SEO Premium plugin. -->","yoast_head_json":{"title":"Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor - Dream Body Clinic Stem Cell Therapy Puerto Vallarta Mexico 2026 &amp; HGH","description":"Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor. Kidney Failure stem cell treatment","robots":{"index":"noindex","follow":"follow","max-snippet":"max-snippet:-1","max-image-preview":"max-image-preview:large","max-video-preview":"max-video-preview:-1"},"og_locale":"en_US","og_type":"article","og_title":"Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor","og_description":"Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor. Kidney Failure stem cell treatment","og_url":"https:\/\/dreambody.clinic\/demo\/mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor\/","og_site_name":"Dream Body Clinic Stem Cell Therapy Puerto Vallarta Mexico 2026 &amp; HGH","article_publisher":"https:\/\/www.facebook.com\/dreambodyclinic","article_modified_time":"2024-04-01T01:22:26+00:00","og_image":[{"width":1200,"height":800,"url":"https:\/\/dreambody.clinic\/demo\/wp-content\/uploads\/2021\/12\/Mesenchymal-Stem-Cells-Therapy-in-Acute-Renal-Failure_-Possible-Role-of-Hepatocyte-Growth-Factor-1.webp","type":"image\/webp"}],"twitter_card":"summary_large_image","twitter_site":"@DreamBodyClinic","twitter_misc":{"Est. reading time":"23 minutes"},"schema":{"@context":"https:\/\/schema.org","@graph":[{"@type":"WebPage","@id":"https:\/\/dreambody.clinic\/demo\/mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor\/","url":"https:\/\/dreambody.clinic\/demo\/mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor\/","name":"Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor - Dream Body Clinic Stem Cell Therapy Puerto Vallarta Mexico 2026 &amp; HGH","isPartOf":{"@id":"https:\/\/dreambody.clinic\/demo\/#website"},"primaryImageOfPage":{"@id":"https:\/\/dreambody.clinic\/demo\/mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor\/#primaryimage"},"image":{"@id":"https:\/\/dreambody.clinic\/demo\/mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor\/#primaryimage"},"thumbnailUrl":"https:\/\/dreambody.clinic\/demo\/wp-content\/uploads\/2021\/12\/Mesenchymal-Stem-Cells-Therapy-in-Acute-Renal-Failure_-Possible-Role-of-Hepatocyte-Growth-Factor-1.webp","datePublished":"2021-12-13T22:08:57+00:00","dateModified":"2024-04-01T01:22:26+00:00","description":"Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor. Kidney Failure stem cell treatment","breadcrumb":{"@id":"https:\/\/dreambody.clinic\/demo\/mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor\/#breadcrumb"},"inLanguage":"en-US","potentialAction":[{"@type":"ReadAction","target":["https:\/\/dreambody.clinic\/demo\/mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor\/"]}]},{"@type":"ImageObject","inLanguage":"en-US","@id":"https:\/\/dreambody.clinic\/demo\/mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor\/#primaryimage","url":"https:\/\/dreambody.clinic\/demo\/wp-content\/uploads\/2021\/12\/Mesenchymal-Stem-Cells-Therapy-in-Acute-Renal-Failure_-Possible-Role-of-Hepatocyte-Growth-Factor-1.webp","contentUrl":"https:\/\/dreambody.clinic\/demo\/wp-content\/uploads\/2021\/12\/Mesenchymal-Stem-Cells-Therapy-in-Acute-Renal-Failure_-Possible-Role-of-Hepatocyte-Growth-Factor-1.webp","width":1200,"height":800},{"@type":"BreadcrumbList","@id":"https:\/\/dreambody.clinic\/demo\/mesenchymal-stem-cells-therapy-in-acute-renal-failure-possible-role-of-hepatocyte-growth-factor\/#breadcrumb","itemListElement":[{"@type":"ListItem","position":1,"name":"Home","item":"https:\/\/dreambody.clinic\/demo\/"},{"@type":"ListItem","position":2,"name":"Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor"}]},{"@type":"WebSite","@id":"https:\/\/dreambody.clinic\/demo\/#website","url":"https:\/\/dreambody.clinic\/demo\/","name":"Dream Body Clinic","description":"Dream Body Clinic Stem Cells - Stem Cell Therapy Puerto Vallarta Mexico  2026 &amp; HGH","publisher":{"@id":"https:\/\/dreambody.clinic\/demo\/#organization"},"alternateName":"dreambodyclinic","potentialAction":[{"@type":"SearchAction","target":{"@type":"EntryPoint","urlTemplate":"https:\/\/dreambody.clinic\/demo\/?s={search_term_string}"},"query-input":{"@type":"PropertyValueSpecification","valueRequired":true,"valueName":"search_term_string"}}],"inLanguage":"en-US"},{"@type":"Organization","@id":"https:\/\/dreambody.clinic\/demo\/#organization","name":"Dream Body Clinic","url":"https:\/\/dreambody.clinic\/demo\/","logo":{"@type":"ImageObject","inLanguage":"en-US","@id":"https:\/\/dreambody.clinic\/demo\/#\/schema\/logo\/image\/","url":"https:\/\/dreambody.clinic\/demo\/wp-content\/uploads\/2023\/06\/logotipo-dream-body-clinic-a-color-sin-fondo.webp","contentUrl":"https:\/\/dreambody.clinic\/demo\/wp-content\/uploads\/2023\/06\/logotipo-dream-body-clinic-a-color-sin-fondo.webp","width":1920,"height":1305,"caption":"Dream Body Clinic"},"image":{"@id":"https:\/\/dreambody.clinic\/demo\/#\/schema\/logo\/image\/"},"sameAs":["https:\/\/www.facebook.com\/dreambodyclinic","https:\/\/x.com\/DreamBodyClinic","http:\/\/instagram.com\/jtkjtk","https:\/\/twitter.com\/DreamBodyClinic","https:\/\/www.pinterest.com.mx\/clinic1831\/","https:\/\/www.youtube.com\/channel\/UC9NfLfVu_mio--j4U3GO4sw"],"description":"Dream Body Clinic is the Premier Destination for Mesenchymal Stem Cell Therapy and Regenerative Medicines such as Human Growth Hormone (HGH).","email":"info@dreambodyclinic.net","telephone":"8887043977","legalName":"Dream Body Clinic","foundingDate":"2013-01-18"}]}},"_links":{"self":[{"href":"https:\/\/dreambody.clinic\/demo\/wp-json\/wp\/v2\/pages\/13278","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/dreambody.clinic\/demo\/wp-json\/wp\/v2\/pages"}],"about":[{"href":"https:\/\/dreambody.clinic\/demo\/wp-json\/wp\/v2\/types\/page"}],"author":[{"embeddable":true,"href":"https:\/\/dreambody.clinic\/demo\/wp-json\/wp\/v2\/users\/1"}],"replies":[{"embeddable":true,"href":"https:\/\/dreambody.clinic\/demo\/wp-json\/wp\/v2\/comments?post=13278"}],"version-history":[{"count":0,"href":"https:\/\/dreambody.clinic\/demo\/wp-json\/wp\/v2\/pages\/13278\/revisions"}],"wp:featuredmedia":[{"embeddable":true,"href":"https:\/\/dreambody.clinic\/demo\/wp-json\/wp\/v2\/media\/13282"}],"wp:attachment":[{"href":"https:\/\/dreambody.clinic\/demo\/wp-json\/wp\/v2\/media?parent=13278"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}