Dream Body Clinic

Mesenchymal Stem Cells Therapy in Acute Renal Failure

Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor. To heal your kidneys check out Kidney Failure Treatment with Direct Stem Cell Injections at dream body clinic.

Mesenchymal Stem Cells Therapy in Acute Renal Failure Possible Role of Hepatocyte Growth Factor

Introduction for Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible Role of Hepatocyte Growth Factor Study

Acute renal failure (ARF), also known as acute kidney injury, is a
rapid loss of renal functions due to damage to the kidneys, resulting in
retention of the nitrogenous compounds (urea and creatinine) and non
nitrogenous waste products that are normally excreted in urine [1].
Depending on the severity and duration of renal dysfunction,
this accumulation is accompanied by metabolic disturbances, such as
metabolic acidosis and hyperkalemia, changes in body fluid balance,
and effects on many other organ systems. It can be characterized by
oliguria or anuria [2]. It is a serious disease and treated as medical
emergency.
In clinical practice, ischemia-reperfusion (I/R) injury is the most
common cause for acute renal failure. The pathogenic events in
ischemia/reperfusion injury include acute tubular necrosis, apoptosis,
glomerular injury and inflammation.
Management of acute renal failure depends first on correction of
the metabolic abnormalities like the correction of hyperkalemia and
correction of metabolic acidosis then treatment of the cause as correction
of the hypovolemic state during shock or immunosuppressive therapy
for glomerulonephritis [3]. Although a number of agents and growth
factors have been proven effective in the amelioration of ARF in
otherwise healthy animals, no significantly effective new therapy has
been introduced into clinical practice in decades. It is for these reasons
that fundamentally new strategies for the treatment of ARF are needed.
Stem cell therapy holds a great promise for the repair of injured
tissues and organs, including the kidney. Stem cells are undifferentiated
cells that undergo both self-renewal and differentiation into one or
more cell types [4], & are found in adult and embryonic tissues and
have potential uses in therapies designed to repair and regenerate
organs. There has been considerable focus on the ability of stem cells
to differentiate into non-haematopoietic cells of various tissue lineages,
including cells of the kidney [5]. This growing evidence has led to a
reconsideration of the source of cells contributing to renal repair
following injury.
The mechanism of action of stem cell therapy is unclear in most
disease conditions. Very-low-level organ engraftment of circulating
bone marrow-derived stem cells has been shown [6] but was not
corroborated by others [7]. The percentage of incorporated stem
cells varies widely, but it is usually below 1% in a given organ, and,
in addition, its magnitude depends on the studied disease model.
Other mechanistic possibilities for the therapeutic effects of stem cells
include fusion with resident organ cells [8], immunomodulation [9]
and paracrine mechanisms elicited through trophic mediators [10]
that result in the inhibition of fibrosis and apoptosis, enhancement of
angiogenesis, stimulation of mitosis and proliferation & differentiation
of organ-intrinsic precursor of stem cells.
Hepatocyte growth factor (HGF), first identified by Russell et
al. [11] then purified and cloned by Nakamura et al. [12] as a potent
mitogen for fully differentiated hepatocytes.
Hepatocyte growth factor exerts mitogenic responses in renal
epithelial cells derived from distinct regions and species, including
rabbit and rat proximal tubular cells [13] and rat glomerular epithelial
cells. HGF stimulates the proliferation of renal epithelial cell lines,
including a rat visceral glomerular cell line [14], proximal tubular cell
lines [15]. Likewise, HGF exhibits mitogenic action on renal endothelial
cells [16].
Many studies demonstrated that HGF can play a role in the
treatment of renal diseases such as acute renal failure caused by
nephrotoxic drug administration (for example, cisplatin, cyclosporine
A, tacrolimus, and antibiotics) and renal ischemia [17].
This work aims: To study the effect of mesenchymal stem cells
(MSC) as a line of treatment for acute renal failure and the possible
mechanism by which they act through studying their effect on the
inflammatory and vascular manifestations. Also, to study the effect of
hepatocyte growth factor (HGF) as another line of treatment for acute
renal failure with comparison between both lines.

Materials & Methods
Preparation of the animal model
Experimental animals: The study was carried on 50 female white
albino rats, of an average weight 150-200 gm. Rats were bred and
maintained in an air-conditioned animal house with specific pathogenfree
conditions, and were subjected to a 12:12-h daylight/darkness and
allowed unlimited access to chow and water. All the ethical protocols
for animal treatment were followed and supervised by the animal
facilities, Faculty of Medicine, Cairo University. They were divided into
5 groups as follow:
Group 1: 10 control female albino rats
Group (2) 10 female albino rats with induced acute renal failure
received saline.
Citation: Abdel Aziz MT, Wassef MA, Rashed LA, Mhfouz S, Omar N, et al. (2011) Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible
Role of Hepatocyte Growth Factor. J Stem Cell Res Ther 1:109. doi:10.4172/2157-7633.1000109
Page 2 of 7
J Stem Cell Res Ther Volume 1 • Issue 3 • 1000109
ISSN:2157-7633 JSCRT, an open access journal
Acute renal failure was induced by ischemia / reperfusion injury by
anaesthetizing the rats with sodium thiopental through intramuscular
injection then doing mid abdominal laparotomy then kidneys were
exposed and bilateral renal pedicles were clamped with atraumatic
vascular clamps for 60 minutes. Then the vascular clamp was released
to allow the reperfusion of the ischemic kidneys. The mid abdominal
laparotomy wound was then sealed by continuous 6/0 stitches in 2
layers. Finally, antibiotic ointment (teramycin) & powder (neomycin)
were applied to the wound [18].
Group (3) 10 female albino rats with induced ARF received HGF in
a dose of (o.25mg/kg body weight) by IV infusion at the rat tail vein 24
hours after the induction of ARF.
Group (4) 10 female albino rats with induced ARF received MSCs,
which were processed and cultured for 14 days, in a dose of (107) by IV
infusion at the rat tail vein 24 hours after the induction of ARF.
Group (5) 10 female albino rats with induced ARF received both
MSCs, which were processed and cultured for 14 days, in a dose of (107)
& HGF in a dose of (0.25mg/kg body weight) by IV infusion at the rat
tail vein 24 hours after the induction of ARF.
Blood samples were collected from the retro-orbital vein. Sera were
separated and used for measurement of Creatinine & urea.
The rats of all groups were sacrificed (by co2 narcosis) after 72 hours
of induction of the acute renal failure to obtain renal tissue specimens.
These tissues were examined for:
-quantitaive analysis of tumor necrosis factor-α (TNF- α),
interleukin-10(IL-10), vascular endothelial growth factor (VEGF) gene
expression by Real Time PCR.
-Histopathological examination of renal tissue by haematoxylin
and eosine and by differential stains (periodic acid shift PAS stain and
masson trichrome stain).
-Detection of the MSCs homing in kidney tissue after its
labeling with PKH26 dye by fluorescent microscope to detect its red
fluorescence.
Preparation of BM -derived mesenchymal stem cells from
rats
Bone marrow was harvested by flushing the tibiae and femurs of
6-week-old male white albino rats with Dulbecco’s modified Eagle’s
medium (DMEM, GIBCO/BRL) supplemented with 10% fetal bovine
serum (GIBCO/BRL). Nucleated cells were isolated with a density
gradient [Ficoll/Paque (Pharmacia)] and resuspended in complete
culture medium supplemented with 1% penicillin–streptomycin
(GIBCO/BRL). Cells were incubated at 37°C in 5% humidified CO2
for 12–14 days as primary culture or upon formation of large colonies.
When large colonies developed (80–90% confluence), cultures were
washed twice with phosphate buffer saline(PBS) and the cells were
trypsinized with 0.25% trypsin in 1mM EDTA (GIBCO/BRL) for 5
min at 37°C. After centrifugation, cells were resuspended in serumsupplemented
medium and incubated in 50 cm2 culture flask (Falcon).
The resulting cultures were referred to as first-passage cultures [19].
Cells were identified as being MSCs by their morphology, adherence,
and their power to differentiate into osteocytes and chondrocytes.
Differentiation into osteocytes was achieved by adding 1-1000
nM dexamethasone, 0.25 mM ascorbic acid, and 1-10 mM betaglycerophosphate
to the medium. Differentiation of MSCs into
osteoblasts was confirmed by morphological changes, Alzarin red
staining of differentiated osteoblasts. Differentiation into chondrocyte
was achieved by adding 500 ng/mL bone morphogenetic protein-2
(BMP-2;R&D Systems, USA) and 10 ng/ml transforming growth factor
b3 (TGFb3) (Peprotech, London) for 3 weeks. In vitro differentiation
into chondrocytes was confirmed by morphological changes, Alcian
blue staining of differentiated chondrocytes. CD29 gene expression
was also detected by RT-PCR as a marker of MSCs and CD45, CD44 by
flow cytometry analysis.
Labeling of MSCs with PKH26
MSCs were harvested during the 4th passage and were labeled
with PKH26, which is a red fluorochrome. It has excitation (551nm)
and emission (567 nm) characteristics compatible with rhodamine or
phycoerythrin detection systems. The linkers are physiologically stable
and show little to no toxic side-effects on cell systems. Labeled cells
retain both biological and proliferating activity, and are ideal for in
vitro cell labeling, in vitro proliferation studies and long, in vivo cell
tracking. In the current work, MSCs were labeled with PKH26from
Sigma Company (Saint Louis, Missouri USA). Cells were centrifuged
and washed twice in serum free medium. Cells were pelleted and
suspended in dye solution. Cells were injected intravenously into rat tail
vain. After one month, kidney tissue was examined with a fluorescence
microscope to detect and trace the cells.
RT-PCR Detection of CD29 gene expression
Total RNA was extracted from cells using RNeasy Purification
Reagent (Qiagen, Valencia, CA), and then a sample (1 μg) was reverse
transcribed with M-MLV (Moleny – Murine Leukemia virus) reverse
transcriptase (RT) for 30 minutes at 42°C in the presence of oligo-dT
primer. Polymerase chain reaction (PCR) was performed using specific
primers (UniGene Rn.25733) forward: 5’-AA TGTTTCAGTGCA GA
GC-3’ and reverse: 5’- TTGGGAT GA TGTCGGGAC-3’. PCR was
performed for 35 cycles, with each cycle consisting of denaturation
at 95°C for 30 seconds, annealing at 55°C to 63°C for 30 seconds,
and elongation at 72°C for 1 minute, with an additional 10-minute
incubation at 72°C after completion of the last cycle. To exclude the
possibility of contaminating genomic DNA, PCRs were also run without
RT. The PCR product was separated by electrophoresis through a 1%
agarose gel, stained, and photographed under ultraviolet light.
Real-time quantitative analyses for VEGF, TNF alpha and
IL10 gene expression
Total RNA was extracted from kidney tissue homogenate using
RNeasy purification reagent (Qiagen, Valencia, CA). cDNA was
generated from 5 μg of total RNA extracted with 1 μl (20 pmol)
antisense primer and 0.8 μl superscript AMV reverse transcriptase for
60 min at 37°C.
The relative abundance of mRNA species was assessed using the
SYBR® Green method on an ABI prism 7500 sequence detector system
(Applied Biosystems, Foster City, CA). PCR primers were designed
with Gene Runner Software (Hasting Software, Inc., Hasting, NY)
from RNA sequences from GenBank (Table 1). All primer sets had
a calculated annealing temperature of 60°. Quantitative RT-PCR
was performed in duplicate in a 25-μl reaction volume consisting of
2X SYBR Green PCR Master Mix (Applied Biosystems), 900 nM of
Citation: Abdel Aziz MT, Wassef MA, Rashed LA, Mhfouz S, Omar N, et al. (2011) Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible
Role of Hepatocyte Growth Factor. J Stem Cell Res Ther 1:109. doi:10.4172/2157-7633.1000109
Page 3 of 7
J Stem Cell Res Ther Volume 1 • Issue 3 • 1000109
ISSN:2157-7633 JSCRT, an open access journal
each primer and 2-3 μl of cDNA. Amplification conditions were 2
min at 50°, 10 min at 95° and 40 cycles of denaturation for 15 s and
annealing/extension at 60° for 10 min. Data from real-time assays
were calculated using the v1·7 Sequence Detection Software from PE
Biosystems (Foster City, CA). Relative expression of VEGF, TNF alpha
and IL10mRNA was calculated using the comparative Ct method. All
values were normalized to the beta actin genes and reported as fold
change over background levels detected in ARF.
Biochemical analysis
Serum urea and creatinine levels were measured using the
conventional colorimetric method using Quanti Chrom TM assay kits
based on the improved Jung and Jaffe methods, respectively (DIUR-
500 and DICT-500).
Analysis of kidney histopathology
Kidney samples were collected into PBS and fixed overnight in 40
g/L paraformaldehyde in PBS at 4°C. Serial 5-μm sections of the cortex
and the medulla of the kidney were stained with hematoxylin and eosin
(H&E).
Statistical analysis
Data were expressed as mean ± SD. Significant differences
were determined by using ANOVA and post-hoc tests for multiple
comparisons using SPSS 9.0 computer Software. Results were
considered significant at p<0.05.
Results
MSCs culture, identification & homing
Isolated and cultured undifferentiated MSCs reached 70-
80% confluence at 14 days .In vitro osteogenic and chondrogenic
differentiation of MSCs were confirmed by morphological changes and
special stains (Figure 1A,B and Figure 2A,B respectively) in addition
MSCs were identified by surface marker CD45 (-ve) & CD44 (+ve)
detected by flow cytometry and CD29 (+) by PCR (Figure 3A,B&C)
respectively. MSCs labeled with PKH26 fluorescent dye was detected
in the renal tissues confirming that these cells homed into the kidney
tissue (Figure 4).
MSCs and or HGF improve the kidney function
The results of the present study show a significant improvement
in kidney function . Serum urea and creatinine were decreased in the
ARF/MSC, ARF/HGF groups compared to the ARF group ((P<0.05)
(Table 1).
Gene expression of inflammatory and angiogenic markers
Concerning gene expression, VEGF & IL-10 genes were
significantly decreased in ARF group (P<0.05) compared to control
group. Whereas their level was significantly increased in the group
that received either MSC alone or MSC and HGF but insignificant in
group that received HGF alone (Figure 5), also these factors showed
negative correlation with P value= P<0.05and R value = – 0.686 and
P value= P<0.05and R value = – 0.744 (Figure 6B&C) respectively. On
the other hand, the TNF-α gene which is one of inflammatory marker
significantly decreased in the rat group that received either MSC alone
Figure 1: Morphological and histological staining of differentiated BM-MSCs
into osteoblasts. (A) (×20) Arrows for differentiated MSCs osteoblasts after
addition of growth factors. (B) (×200) Differentiated MSCs into osteoblasts
stained with Alizarin red stain..
Figure 2: Morphological and histological staining of differentiated BM-MSCs
into chondrocytes. (A) (×20) Arrows for differentiated MSCs chondrocytes after
addition of growth factors. (B) (×200) Differentiated MSCs into chondrocytes
stained with Alcian blue stain.
Figure 3: Flow cytometric characterization analyses of bone marrow-derived
MSCs. Cells were uniformly negative for CD45(A), and positive for CD44(B).
Figure 3(C) Agarose electrophoresis of CD29 PCR products of MSC in culture.
(A) CD 45- (B)CD 44+ (D) CD29
Figure 4: Detection of MSCs labeled with PKH26 fluorescent dye in kidney
tissue. MSCs labeled with the PKH26 showed strong red autofluorescence
after transplantation into rats, confirming that these cells were seeded into the
kidney tissue.
Citation: Abdel Aziz MT, Wassef MA, Rashed LA, Mhfouz S, Omar N, et al. (2011) Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible
Role of Hepatocyte Growth Factor. J Stem Cell Res Ther 1:109. doi:10.4172/2157-7633.1000109
Page 4 of 7
J Stem Cell Res Ther Volume 1 • Issue 3 • 1000109
ISSN:2157-7633 JSCRT, an open access journal
or MSC and HGF but insignificant in group that received HGF alone
(Figure 5) and a significant positive correlation with serum creatinine
concentration among the studied groups (Figure 6A) with P value=
P<0.05 and R value = 0.868.
Histopathological changes
Histopathological examination of kidney tissue of ARF group
showed Tubular atrophy of both proximal & distal tubules with marked
lumen dilatation & cell debris in lumen & patchy loss of proximal tubule
cells with regenerative change in tubular cells. (Figure 7 A PASX400)
following MSC injection there was dense interstitial, periglomerular,
perivascular and diffuse interstitial tissue infiltrates of cells between
tubules at corticomedullary junction (Figure 7 B( PAS X400 X1000).
In ARF/HGF there was minimal kidney damage with Patchy focal
glomerular dilatation of Bowman’s space. The space is partially
filled with fibrin and cell debris (Figure 7C (HEX200) while in ARF/
MSCs+HGF there was cellular infilteration (Figure 7 D (HEX200).
Discussion
Bone marrow–derived stem cells contribute to cell turnover
and repair in various tissue types, including the kidneys [20,21].
Mesenchymal stem cells (MSCs) are attractive candidates for renal
repair, because nephrons are of mesenchymal origin and because
stromal cells are of crucial importance for signaling, leading to
differentiation of both nephrons and collecting ducts [22]. MSCs
are commonly defined as bone marrow–derived fibroblast-like cells,
which despite the lack of specific surface markers can be selected by
their adherence characteristics in vitro and which have the ability
to differentiate along the three principal mesenchymal lineages:
osteoblastic, adipocytic, and chondrocytic [23,24]. In the present study,
bone marrow derived mesenchymal stem cells were isolated from male
rats, grown and characterized by their adhesiveness and fusiform shape
and by detection of CD 29, one of surface marker of rat mesenchymal
stem cells and were used to detect their possible anti-inflammatory and
vascular role in amelioration of renal function in experimental model
Figure 5: Quantitave analysis of VEGF(A) , IL-10 (B) &TNF-α(C) gene expression by real time PCR in different groups(# significant difference to ARF group).
(A) (B) (C)
Figure 6: Correlation between TNF-α (A), IL-10 (B) & VEGF(C) with creatinine(B&C significant positive correlation (A) significant negative correlation).
A B C
Citation: Abdel Aziz MT, Wassef MA, Rashed LA, Mhfouz S, Omar N, et al. (2011) Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible
Role of Hepatocyte Growth Factor. J Stem Cell Res Ther 1:109. doi:10.4172/2157-7633.1000109
Page 5 of 7
J Stem Cell Res Ther Volume 1 • Issue 3 • 1000109
ISSN:2157-7633 JSCRT, an open access journal
of acute renal fai decrease in serum urea and creatinine concentrations
than those of the ARF group. Our results were similar to those of Dai
[27], who proved that a Single Injection of naked plasmid encoding
hepatocyte growth factor prevented cell death and ameliorated acute
renal functions in mice. The possible mechanism is that hepatocyte
growth factor exerts mitogenic responses in renal epithelial cells
derived from distinct regions and species, including rabbit and rat
proximal tubular cells .HGF also stimulates the proliferation of renal
epithelial cell lines, including a rat visceral glomerular cell line [14],
proximal tubular cell lines [15].
Following stem cell injection, those donors cells could be detected
in recipient failing kidneys by autofluorescence that appeared in kidney
tissue after MSCs injection .The result of the present work showed
strong red auto fluorescence after transplantation in rats, confirming
Figure 7: Histopathological examination of renal tissues in different groups:
(A)ARF showed atrophy and patchy necrosis of proximal and distal renal
tubules & cell debris in the lumen. (B)ARF+ MSC(B) & ARF+MSC+HGF(D)
showing dense interstitial tissue infiltrate between tubules at corticomedullary
junction.(D)ARF+HGF (C), showed fibrin and cell debris in cortical tubules.
A B
C D
Primer sequence
VEGF Forward:5’GCCTGAAATCTACCAGATCATGTTG 3΄
Reverse:3’TTCCACAAGCTCCACGAATCTT 5΄
TNF-α Forward :5′ GACCCTCACACTCAG ATC ATC TTC T -3′
Reverse :3′ TTGTCTTTGAGATCCATGCCA TT 5′
IL-10 Forward :5΄ GAA GCT GAA GAC CCT CTG GAT ACA 3΄
Reverse : 3΄ TTG TCT TTG AGA TCC ATG CCA TT 5΄
Beta actin forward 5′-TGTTGTCCCTGTATGCCTCT-3′
reverse 3′-TAATGTCACGCACGATTTCC-5′
Table 1: Sequence of the primers used for real-time PCR.
Table 2: Serum urea (mg/dl) & creatinine (mg/dl) in different studied groups:
*Significant p as compared to control group (P<0.05)

Significant p as compared to ARF group (P<0.05)

$Significant p as compared to ARF with HGF group (P<0.05)
groups urea (mg/dl) mean± SD creatinine (mg/dl) mean± SD
control 33.39 ± 7.95 0.16 ± 0.08
ARF 82.73 ± 10.28* 1.63 ± 0.44*
ARF with HGF 69.79 ± 7.52# 1.06 ± 0.27#
ARF with stem cells 49.28 ± 6.31#$ 0.6 ± 0.16#$$
ARF with stem cells & HGF 43.73 ± 9.20#$ 0.5 ± 0.11#$
that these cells were actually insinuating themselves into the renal tissue
as detected by fluorescent microscope. This result was in accordance to
that reported by Morigi et al. [28], who labeled a human bone marrow
MSCs with PKH 26 dye and administered it into mice with induced
acute renal failure and found the red fluorescence of the MSC.
Fusion or transdifferentiation, this could not be answered in this
study, However, both techniques definitely proved that those cells were
able to maintain high population all through the study, in other words,
for 3 days following MSC injection. These results agree with those
of Li et al. [29]; who showed 50% replacement of proximal tubular
cells with donor cells. These results also agree with Rookmaaker et
al. [30]; who declared that bone-marrow-derived cells may home to
injured glomerular endothelium, differentiate into endothelial cells,
and participate in regeneration of the highly specialized glomerular
microvasculature. In addition, they confirmed previous observations
that bone-marrow-derived cells can replace injured mesangial cells
[31]. Tögel et al. [18]; stated that infused MSC were detected in the
kidney only early after administration and were predominantly in
glomeruli
Duffield et al. [32]; state that BDMC contribute a regenerative
cytokine environment that may be important in the resulting functional
repair. Similarly, it was found that bone marrow–derived stem cells
seemed to contribute relatively small numbers of cells (3 to 22%) to
regenerating renal tubular [33] and glomerular cell populations [21];
that is, the majority of reparative cells were derived from intrinsic
kidney cells. Regardless the cause, whether it’s MSC differentiation,
fusion or merely cytokine induced renal improvement; following MSC
injection, the results of the present work showed increase in IL10 and
VEGF and decrease in TNF gene expression in renal tissues. Several
studies stated that after 24 h of MSCs infusion, only exceptionally scarce
numbers of MSCs were found in the kidney, a pattern that essentially
rules out the possibility that significant numbers of infused MSCs are
retained in the kidney where they could physically replace lost kidney
cells by transdifferentiation. This conclusion is furthermore supported
by the fact that there were no intrarenal transdifferentiation events
of MSC within 3 days of administration, whereas occasional MSCderived
capillary endothelial cells were identified only after 5–7 days.
From this, it could be deduced that the mechanisms that mediate the
protective effects of MSC must be primarily paracrine. This is proved
by their expression of several growth factors such as HGF, VEGF, and
IGF-I, all known to improve renal function in CRF, mediated by their
antiapoptotic, mitogenic and other cytokine actions. Collectively,
these as yet incompletely defined paracrine actions of MSC result in
the renal downregulation of proinflammatory cytokines IL-1β, TNF-α,
and IFN-γ, as well as iNOS, and upregulation of anti-inflammatory
and organ-protective IL-10 [34], as well as bFGF, TGF-α, and Bcl-

The lack of renoprotection obtained by infused fibroblasts may
be due, at least in part, to the fact that MSC exhibit a comparatively
higher expression of VEGF, HGF, and IGF-I, therefore suggesting that
the combined delivery, by MSC, of these factors appears to result in
superior renoprotection than that obtained with the growth factors
that are more highly expressed by fibroblasts (EGF, HB-EGF, BMP-7,
bFGF).
Histopathological examination of renal tissue samples of ARF group
showed increased congestion & increased cellularity of the glomeruli &
fibrin deposition. There was also patchy tubular atrophy & necrosis. On
Citation: Abdel Aziz MT, Wassef MA, Rashed LA, Mhfouz S, Omar N, et al. (2011) Mesenchymal Stem Cells Therapy in Acute Renal Failure: Possible
Role of Hepatocyte Growth Factor. J Stem Cell Res Ther 1:109. doi:10.4172/2157-7633.1000109
Page 6 of 7
J Stem Cell Res Ther Volume 1 • Issue 3 • 1000109
ISSN:2157-7633 JSCRT, an open access journal
the other hand normal medullary tubules with vacuolar degeneration
as a late event were seen. Interstitial edema & mild inflammation also
occurred. MT showed dense fibrosis invaded by a dense collection of
MSCs which were indicated by autofluorescence in kidney tissue after
MSCs injection. Those were examined with H&E stain, that is a more
sensitive detector regarding cellular infiltration, & finally with Mason
Dichromate, which is a better detector of collagen fibers hence, fibrosis
& scaring. The present findings agreed with those of [29]; who recorded
similar perivascular & periglomerular infiltration. In addition, they
reported cell fusion, with occurrence of binucleated cells.
In the current study when HGF was administered after 24 hours,
there were patchy focal glomerular dilatation of Bowman’s space
and the space was partially filled with fibrin and cell debris. Rest of
glomeruli appeared normal. Cortical tubules showed patchy areas of
minimal necrosis & degeneration mostly hyaline & vacuolar as well
as atrophy & tubular dilatation. This finding agreed with Kawaida K
et al. [35], who stated that HGF prevents ARF and accelerates renal
regeneration in mice and in accordance with Miller et al. [36], who
stated that Hepatocyte growth factor accelerates recovery from acute
ischemic renal injury in rats.
Using stem cell–enriching and/or cytokine-enriching strategies
after ARF, we found the effect of the injected cytokines HGF to be
more important to improve kidney function than the transplanted
MSCs alone. Our data therefore support the emerging findings that
stem cell therapy may enhance kidney function primarily via paracrine
mechanisms as opposed to a regeneration of new renal tissue. Although
MSCs are capable of producing a great variety of cytokines, including
HGF. HGF -enhanced MSCs showed increased cytokine expression
in vivo and maximized the beneficial paracrine effects of MSC
transplantation.
In conclusion, MSC & HGF can exert their effect by paracrine
mechanisms through down regulation of proinflammatory cytokine
TNF-α and up regulation of anti-inflammatory IL-10 and VEGF.
References
Albright RC Jr (2001) Acute renal failure: a practical update. Mayo Clin Proc 76:
67-74.
Singri N, Ahya SN, Levin ML (2003) Acute renal failure. JAMA 289: 747-751.
Kodner CM, Kudrimoti A (2003) Diagnosis and management of acute interstitial
nephritis. Am Fam Physician 67: 2527-3534.
Weissman IL (2000) a: Stem cells: units of development, units of regeneration,
and units in evolution. Cell 100: 157–168.
Oswald J, Boxberger S, Jorgensen B, Feldmann S, et al. (2004) Mesenchymal
stem cells can be differentiated into endothelial cells in vitro. Stem Cells 22:
377–384.
Orlic D, Kajstura J, Ghimenti S, Jakoniuk I, et al (2001) Bone marrow cells
regenerate infracted myocardium. Nature 410: 701-705.
Balsam LB, Wagers AJ, Christensen JL, Kofidis T, et al. (2004) Hematopoietic
stem cells adopt mature hematopoietic fates in ischemic myocardium. Nature
428: 668–673.
Wurmser AE, Gage FH (2002) Stem cells: cell fusion causes confusion. Nature
416: 485–487.
Aggarwal S, Pittenger MF (2005) Human mesenchymal stem cells modulate
allogeneic immune cell responses. Blood 105: 1815-1822.
Ready to Reclaim Your Health?

Call (888) 704-3977

For a Free Consultation

Or email us at info@dreambodyclinic.net